Journal: bioRxiv

Article Title: Single-component optogenetic control enables human portrait formation in cells

doi: 10.1101/2025.11.13.688218

Figure Lengend Snippet: Light-dependent degradation of DmCRY in HEK293T cells and design of DmCRY-based inducible expression systems. ( A ) Immunoblots showing degradation of DmCRY-TetR and DmCRY-V5His (DmCRY) in HEK293T cells after exposure to 1,000 or 2,000 lux white light for 24 h. TetR fusion at the C terminus attenuated but did not abolish light-dependent degradation compared with DmCRY-V5His (wild-type reference). ( B ) Design of light- and tetracycline-inducible plasmids. Effector cassettes encoding GFP/Luc (a), dCas9 (b), or Cas9 (c) were placed downstream of TetR-responsive operator (TO) sequences. DmCRY-TetR, expressed from a separate cassette, binds TO sites to repress CMV-driven transcription. Removal of DmCRY-TetR by light-dependent degradation or tetracycline/doxycycline relieves promoter repression. VP, VP64 or VPR; Luc, luciferase cassette; pA, polyadenylation signal; R, resistance. ( C ) Doxycycline displaced DmCRY-TetR from OT sites, permitting CMV-dependent GFP expression and confirming TetR functionality in the DmCRY-TetR fusion. ( D ) Similarly, doxycycline displaced DmCRY-TetR from TO sites, permitting CMV-dependent expression of dCas9-VP64 and Cas9. Molecular weights (kDa) are shown to the left of blots. “Mock” indicates cells processed in parallel without plasmid transfection. Quantification and statistics for A, C , and D are given in SI Appendix , Figs. S1 A –S1 C , respectively.

Article Snippet: Directional cloning of Cas9 into the Blunt and BamHI site of pcDNA4.TO/MycHisA resulted in pcDNA4.TO-Cas9 plasmid. pcDNA4.TO-dCas9-VP64 was obtained through a multi-step cloning strategy. dCas9 was amplified from pcDNA3.1-CibN-dCas9-CibN (Addgene no. 60553) ( ) using oligos 5’ GATCTCGAGCATCACGATTACAAGGATG 3’ and 5’ CCCTCTAGAAACTTTGCGTTTCTTTT 3’ sequences and inserted into XhoI-XbaI site of pcDNA4.MycHisA to obtain pcDNA4.dCas9.

Techniques: Expressing, Western Blot, Luciferase, Plasmid Preparation, Transfection

Journal: bioRxiv

Article Title: Single-component optogenetic control enables human portrait formation in cells

doi: 10.1101/2025.11.13.688218

Figure Lengend Snippet: ( A ) Recombinant gene expression control through dCas9-VP64 was tested by monitoring GFP reporter expression. cc-pcDNA4.TO-dCas9-VP64 was co-transfected with the GFP reporter and the sgRNA plasmid targeting the reporter (see Methods). In this design, the expression of the effector (dCas9-VP64) occurs first and then the accumulated dCas9-VP64 subsequently activates GFP transcription. Therefore, only 48 h and 72 h samples were analyzed by Western blotting to assess reporter activation. Quantification and statistical analysis are shown in SI Appendix , Fig. S4. ( B ) Endogenous gene transcription control. Since VPR is reported to be more potent than VP64 for activating endogenous genes, HEK293T cells were co-transfected with cc-pCDNA4.TO-dCas9-VPR and lentiGuide-Puro-CRY1 plasmids. Induction was measured at the transcriptional level by qPCR. Statistical analyses were performed using two-way ANOVA followed by Tukey’s multiple comparisons test in GraphPad Prism. Significance thresholds were defined as: ns < 0.1234, *p < 0.0332, **p < 0.0021, ***p < 0.0002,****p < 0.0001. Results are presented as mean ± SD (n = 5).

Article Snippet: Directional cloning of Cas9 into the Blunt and BamHI site of pcDNA4.TO/MycHisA resulted in pcDNA4.TO-Cas9 plasmid. pcDNA4.TO-dCas9-VP64 was obtained through a multi-step cloning strategy. dCas9 was amplified from pcDNA3.1-CibN-dCas9-CibN (Addgene no. 60553) ( ) using oligos 5’ GATCTCGAGCATCACGATTACAAGGATG 3’ and 5’ CCCTCTAGAAACTTTGCGTTTCTTTT 3’ sequences and inserted into XhoI-XbaI site of pcDNA4.MycHisA to obtain pcDNA4.dCas9.

Techniques: Recombinant, Gene Expression, Control, Expressing, Transfection, Plasmid Preparation, Western Blot, Activation Assay